The attachment of nucleotides to form a complementary strand of DNA during replication?
a. is accomplished by DNA polymerase.
During replication daughter strand was synthesized has a complimentary sequence 5'Aggtccagcccattgcgaatacgcaag3... What are the parent strands?
I don't understand mentalflames's answer: why is a biology question inappropriate in the biology category. OK first of all the bases are always to be done in CAPITAL letters. If the sequence is AGGTCCAGCCCATTGCGAATACGCAAG the complementary (it's complementary, the opposite; it's not complimentary, i.e. nice) sequence of the parent strand is AGGTCCAGCCCATTGCGAATACGCAAG. You really should learn the complementary base pairs. They're easy to remember and it could mean the difference in one exam mark which can make a diiference of one grade. A and T are always one pair and C and G the other pair.
If a genetic mistake took place during replication and the new DNA strand has the sequence CAG what amino acid?
The sequence of the template strand. As you know, A continually goes with T and G continually goes with C. The template strand has its own designated nucleotide sequence where the brand new strand have to follow.
What is the importance of the DNA complementary strand?
The problem here, and it's a BIG one in biology, is the use of numerous ambiguous terms for the two antiparallel strands in double stranded DNA (sDNA). Another ambiguity is if one is talking about dsDNA replication, or its transcription to pre-mRNA.In DNA replication both original strands are separated and DNA polymerase adds complimentary bases (5' to 3') to both original strands. Thus, when completed, you now have two identical dsDNA double helices, and the cell can get on with mitosis.It gets a bit funkier when one discusses transcription of dsDNA to messenger RNA (mRNA, or "pre-mRNA" in eukaryotes). In this process, the dsDNA is "unzipped" by the RNA polymerase down the centerline for ~a dozen or so bases. This region is called the "transcription bubble" In the cartoon below the bottom bracket shows the "bubble," and the new mRNA (red) is formed by complementary paring with the template strand but has uracils in place of thymine (U vs T). That mRNA codes for the sequence of amino acids (AAs) the form proteins at the ribosome. The next BIG ambiguity arises from biology's failure to standardize terminology: The text above uses "coding" vs "template" strands. The image below, showing the same process, uses the terms "template" vs "nontemplate" strandsThe next image (below) uses "sense" vs "antisense" strandsThe term "complimentary strand" is also terribly ambiguous as both strands of dsDNA are perfectly complementary to one another, as is the short bit of DNA/RNA hybrid that exists briefly within the "bubble"To try to sort this out, while both strands are complimentary, only one serves as the template for making mRNA, thus I prefer the term "template strand," which, BTW is also called the "antisense strand," the "nontemplate strand" and perhaps other names, as well. However, despite the crazy terminology, the image below gives a general picture of the transcription and translation scheme. I'd substitute "coding" for "sense," and "template" for "antisense" in the cartoon below.NOTE: all these sketches show the exact same process, they differ only in the terminology the authors' have chosen. I wish I could make it clearer, but textbook authors have already made a mess here. Good Luck!
The newly-synthesized strand of DNA has exactly the same base sequence as that of its template strand.?
the two strands of a dsDNA molecule run in opposite instructions. to point path of the strand we upload 5'- CTACGCTAGGCGATTGAACT-3' The complimentary strand will as a result be 3'- GATGCGATCCGCTAACTTGA -5' A pairs with T's and vice versa; G pairs with C and vice versa. to larger visualize this, write the sequence given above on slightly paper. Rotate the piece of paper one hundred eighty ranges on a table in front of you.. Write the compliment making use of the backside pairing policies over the the different way up letters....
What, biologically, rewrites DNA sequence when a mutation occurs?
the mutation can occur -- mutation is a terrible word, by the way -- can occur a number of different ways, but the reason you are confused is that you aren't thinking of the letters as being three dimensional molecules with constrained possibiities for in-place change and for replacement. replacement would likely happen during transcription. but by the time we get to the human or primate genome, it is vastly more complicated in terms of how it represents than a simple linear sequence of letters can bear. there is an interesting book -- i'll just hopefully find it -- anatomy of gene regulation - a three-dimensional structural analysis -- and until it seems one can hold this level of representation in one's head, it's not really possible to understand what really goes on down there in micro land it seems. i know, what a bother. it probably won't be all figured out in my lifetime
What are the main events that occur during DNA replication?
IPMATInterphas, prophase, Metaphasr, Anaphase, and tellophase.Prophase makes the preperation of centrioles, which produce spindle fibers.Metaphase is the point where the chromsomes meet in the center of the spindlefibers.Anaphase sees the chromosome split in half, into chromatids.Telophase :the chromatids have the dna they need replaced by the rough ERS message, Trna, which is made up by the ribosomes and forms 2 chromatids know as a chromosome, the cell wall is fully encloses by this point, you have yourseld a cellular clone through the process of Mitosis.Mieosis has more steps.I am a bit rusty in this, i need to brush up a bit, but i think i hit the nail on the head, haha
Why does semi-conservative replication occur?
I interpreted your question as "why doesn't the parent strand make a copy of itself and then come back together?" which would be a conservative model of replication. The most straightforward answer to your question is that semiconservative replication is efficient. Each strand of DNA contains all the genetic information that is needed, with a single strand you can use complimentary base pairing to create a new strand that was identical to the old one that it was bound to.Because both strands can replicate the genome, it becomes much more efficient to do sermi-conservative replication.1.Single DNA strand is "unzipped" with helicase. 2.Each single stranded DNA gets a complimentary strand synthesized by DNA polymerase.3.DNA backbone is cemented by DNA polymerase. Everything is wound back onto the histone proteins. And you're done. In theory, both of these are completely identical to the parent DNA (including epigenetic markers, those are copied onto the daughter strands too) and the cell wouldn't need to reform the parent strand because it's unnecessary. Think, it would take extra steps.The most efficient way to conservatively replicate DNA would be to then, after the steps above:"Unzip" each daughter strand (in case you're wondering why you can't just start from step 2 previously, the nucleotides are only hydrogen bonded to their complements, and they aren't attached to each other, if helicase went through then, you would just have a bunch of free floating nucleotides again).Pair the parent strands together again, pair the daughter strands together, separate them, and wind them up onto their histones again.These steps require energy, breaking bonds, creating bonds, and moving things all require energy, an estimated 60,000 molecules of ATP per second are consumed during replication. Because semi-conservative replication involves less steps (less doing stuff), it is more efficient than conservative replication
If the incorrect nucleotide is added to a DNA strand during replication, how is the mistake corrected?
The answer is D. Error correction is a property of some, but not all, DNA polymerases. This process corrects mistakes in newly-synthesized DNA. When an incorrect base pair is recognized, DNA polymerase reverses its direction by one base pair of DNA. The 3'->5' exonuclease activity of the enzyme allows the incorrect base pair to be excised (this activity is known as proofreading). Following base excision, the polymerase can re-insert the correct base and replication can continue.
What is “semiconservative replication of DNA”?
Semiconservative replication means that during DNA replication, each strand of DNA from the original cell is "conserved", or not changed, while a complementary copy is made from "new" nucleotides. The Meselson-Stahl experiment led to the discovery that DNA is replicated semiconservatively. I have linked a video from McGraw Hill that summarizes the experiment.[1] When the cell gets ready to go into either mitosis or meiosis, it needs to replicate its DNA such that each of its daughter cells (for the case of mitosis) would get an equal amount of DNA. Meiosis is slightly different. For relative simplicity, I will focus on mitosis for the example.When the cell gets ready for either mitosis or meiosis, the DNA is said to "unzip" while an enzyme (DNA polymerase) helps assemble the nucleotides. There are more enzymes involved in DNA replication, yet I have left those out of the example. Example: a very simplified, hypothetical, molecule of DNA could have the following sequence (double helix):5' GTACGTACCTAG 3'3' CATGCATGGATC 5'The boldface type is the DNA sequence from the original cell.After replication (S phase), the cell would be left with:5' GTACGTACCTAG 3' 3' CATGCATGGATC 5' and 5' GTACGTACCTAG 3'3' CATGCATGGATC 5'As you note from above, after replication, the original cell has two copies of the exact sequence, barring mutation. One strand of each DNA molecule came from the original cell (the boldface type) and the other strand was synthesized from new nucleotides via DNA polymerase. When the original cell divides, one daughter cell would inherit the top DNA molecule while the other daughter cell would inherit the bottom DNA molecule. Each daughter cell contains a DNA strand that was in the original cell prior to replication.Footnotes[1] Meselson and Stahl Experiment